ORIGINAL ARTICLE

The polysaccharide from Camellia oleifera fruit shell enhances immune responses via activating MAPKs and NF-κB signaling pathways in RAW264.7 macrophages

Chuanqi Xie^1†, Xinying Lin^1,2†, Juwu Hu¹, Shufen Wang¹, Jing Wu¹, Wei Xiong^1* and Lei Wu^1*

¹Institute of Applied Chemistry, Jiangxi Academy of Sciences, Nanchang, P.R. China; ²School of Medicine, Xiamen University, Xiamen, China

Abstract

Background: Macrophage plays an important role in innate immune responses by secreting immune molecules and phagocytosis. Camellia oleifera fruit shell, accounting for approximately 60% weight of the single C. oleifera fruit, is rich in polysaccharides and has several biological activities such as anti-oxidation, lipid regulation and anticancer. However, the immunomodulatory activity of the polysaccharide from C. oleifera fruit shells (CPS) has not been reported.

Objective: This study aimed to investigate the immunomodulatory activities and mechanisms of CPS in RAW264.7 macrophages.

Methods: The Methyl Thiazolyl Tetrazolium (MTT) method was used to evaluate the effect of CPS on the cell viability of RAW264.7 macrophages, and cell morphology was pictured using microscope. The production of immune-related molecules, including nitric oxide (NO), prostaglandin E2 (PGE2), tumor necrosis factor α (TNFα), interleukin (IL)-1β and IL-6, was detected by Griess assay and enzyme-linked immunosorbent assay (ELISA). The protein expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX2) and the phosphorylation level of mitogen-activated protein kinases (MAPKs) were analyzed through western blotting. The mRNA levels of related genes were tested using reverse transcription-polymerase chain reaction (RT-PCR). The nuclear translocation of nuclear factor-kappa B (NF-κB) was detected using immunofluorescence technology.

Results: The results indicated that CPS treatment stimulated the production of NO and PGE2 and significantly enhanced the protein expression of iNOS and COX2 with little effect on the cell morphology and viability. Also, the secretion and mRNA levels of TNFα were increased by the treatment of CPS. In addition, CPS treatment markedly upregulated the phosphorylation level of MAPKs including Extracellular Signal Regulated Kinase (ERK), P38, and c-Jun N-terminal Kinase (JNK) at different time points and caused the activation and nuclear translocation of NF-κB.

Conclusion: Our data implied that CPS exerts immunomodulatory activities by activating MAPKs and NF-κB signaling pathways in RAW264.7 macrophages.

Keywords: C. oleifera fruit shell polysaccharide; RAW264.7 macrophage; immunoregulatory activities; MAPKs, NF-κB

 

 

Macrophages exist in all tissues are a kind of immune cells, which play an important role in the host immune response to the invasion of pathogenic microorganisms and other foreign substances by secreting immune molecules and related cytokines such as nitric oxide (NO), prostaglandin E2 (PGE2), tumor necrosis factor α (TNFα), interleukin (IL)-1β, and IL-6 (1–3). NO and PGE2 are two significant immune molecules involved in a variety of physiological and pathological reactions in the host (4, 5). TNFα, IL-1β, and IL-6 are three typical cytokines regulating immune responses in macrophages, which are considered the marked mediators in several cell processes, including immune reaction, inflammatory response, cell proliferation, and cell apoptosis (6–9).

Mitogen-activated protein kinases (MAPKs) and nuclear factor-kappa B (NF-κB) are two major signaling pathways related to the activation of macrophages, which regulate the secretion and maturation of immune molecules and related cytokines in macrophages. MAPKs are serine/threonine protein kinases presented in most eukaryotes, containing three family members including P38, ERK, and JNK, which can be activated by the transforming growth factor-β (TGF-β)-activated kinase 1 (TAK1) (3, 10). The activation of MAPKs then promotes the nuclear translocation of activation protein 1 (AP1) from cytoplasm, which regulates mRNA transcription via binding to the promoter region of related genes and ultimately causes the secretion and maturation of related cytokines and immune molecules such as inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX2), TNFα, IL-1β, and IL-6 (11–14). NF-κB is an important transcription factor that regulates a series of immune responses by promoting the release of related molecules and enhancing the phagocytosis ability of macrophages (15). NF-κB in the rest state remains in the cytoplasm by binding to the IκB inhibitory protein. Once the cells are stimulated by a foreign substance or pathogen, the IκB inhibitory protein will be phosphorylated by the IκB kinase (IKK) and dissociated from the NF-κB complex and then degraded through ubiquitination. The dissociated NF-κB will be activated and rapidly translocated into nuclear to regulate the transcription of related genes by binding to the mRNA promoter region, ultimately leading to the release of related molecules and the activation of macrophages (16, 17).

C. oleifera fruit shell, accounting for approximately 60% weight of the single C. oleifera fruit, is rich in polysaccharides and has several biological activities such as anti-oxidation, lipid regulation, and anticancer. Xie and colleagues have pointed out that the extracts of C. oleifera fruit shell could scavenge free radicals, inhibit lipid peroxidation, or reduce the body weight of mice induced by high fat diet (18). Jin et al. and Zhang et al. (19, 20) have shown that the polysaccharide from C. oleifera fruit shell (CPS) had promising antitumor activity as well as strong antioxidant activity in vitro and in vivo. However, the immune activity of the polysaccharides extracted from C. oleifera fruit shells (CPS) has not been reported.

In this study, the effects of CPS on immune responses of RAW264.7 macrophages and the underlying mechanisms were evaluated. The results indicated that CPS treatment significantly promoted the production of NO and PGE2 and enhanced the protein expression of iNOS and COX2 with little effect on the cell morphology and viability. Moreover, the secretion and mRNA level of TNF-α were increased by the treatment of CPS. Mechanically, CPS treatment markedly upregulated the phosphorylation level of MAPKs including ERK, P38, and JNK at different time points and promoted the activation and nuclear translocation of NF-κB. In conclusion, our data implied that CPS exerted immunomodulatory activities in RAW264.7 macrophages by activating MAPKs and NF-κB signaling pathways.

Materials and methods

The source of polysaccharides extracted from C. oleifera fruit shell

In this study, C. oleifera fruit shell was provided by Jiangxi enquan grease Co., Ltd (Shangrao, China). The polysaccharide was extracted from C. oleifera fruit shell by water extraction at 100°C for 74.5 min with solid-water ratio of 1:21 g/mL. It was then precipitated with 80% ethanol, followed by decolorization with 25% activated carbon. Finally, the content of polysaccharide was determined using the phenol-sulfuric acid method, and the content of CPS used in this study increased to 34.93%.

Cell culture

RAW264.7 macrophage was a gift from Key Laboratory of Pu-er Tea Science, Ministry of Education, which was cultured in high glucose DMEM media (Biological Industries, Israel) supplemented with 10% fetal bovine serum (Natocor, Argentina) and 1% penicillin and streptomycin (Biological Industries, Israel) at 37°C with 5% CO₂. The cells were observed every day, and the culture medium was changed every 2~3 days.

MTT assay

RAW264.7 cells in logarithmic growth phase were seeded in a 96-well plate (5 × 10⁴ cells/well) and incubated overnight. CPS at a concentration of 25, 50, 100, or 200 µg/mL or Lipopolysaccharide (LPS) (Sigma-Aldrich, USA) at 1 µg/mL was added to the plant and incubated for another 24 h. Then, MTT (Solarbio, Beijing) reagent was supplemented to each well for 4 h at 37°C under the dark condition. Supernatants were entirely aspirated, and Dimethylsulfoxide (DMSO) were added to dissolve the formazan crystals. After shaking for 10 min, the absorbance was measured at 492 nm using a microplate reader (Tecan Infinite 200 Pro, Switzerland).

Griess assay

RAW264.7 cells (5 × 10⁴ cells/well) were inoculated in a 96-well plate overnight and then treated with CPS or LPS for 24 h. The production of NO was measured by the accumulation of nitrites in the culture medium, using the colorimetric Griess reaction with slight modifications. 100 µL of each supernatant medium was mixed with an equal volume of Griess A (0.1% [w/v] N-(1-naphthyl)-ethylenediamine dihydrochloride) and B (1% [w/v] sulphanilamide containing 5% [w/v] H₃PO₄) (1:1) at room temperature for 10 min in the dark. The absorbance was immediately measured at 540 nm, and the concentration of NO was calculated by the standard curve of nitrite.

Enzyme-linked immunosorbent assay

RAW264.7 cells were seeded in a 6-well plate at a density of 1 × 10⁶ cells/well and cultured overnight. Drugs were added in the plate and incubated for 24 h. The supernatants were centrifuged at 15,000 g, 4°C for 10 min and collected for the detection of related immunoregulatory molecules using the enzyme-linked immunosorbent assay (ELISA) method. The contents of TNFα, IL-1β, and IL-6 were determined according to the instructions from the manufacturer of ELISA kit (BIOSTER, Wuhan, China).

Western blotting

RAW264.7 cells (1 × 10⁶ cells/well) were treated with the same way of ELISA or inoculated in dishes with a diameter of 6 cm overnight and stimulated with CPS or LPS for the indicated times, respectively. Then, cells were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (Solarbio, Beijing, China) on ice for 30 min, and proteins were extracted and quantified by BCA Kit (Beyotime, Jiangsu, China). 40 µg of protein was separated via 8 or 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel and then transferred onto Polyvinylidene Fluoride (PVDF) membranes (Millipore, CA, USA). The membranes were blocked with 5% Bovine Serum Albumin (BSA) or skim milk at room temperature for 1 h and then incubated with primary antibodies specific for iNOS, ERK1/2, pERK1/2, P38, and JNK1/2/3 (ABclonal, Wuhan, China), and COX2, Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), p-P38, and pJNK (Bioworld Technology, Inc, MN, USA) at 4°C overnight. The membranes were then incubated for an additional 1 h with goat antirabbit lgG/ Horseradish Peroxidase (HRP) (Bioss, Beijing, China). Then, the membrane was developed using HyperSignal ECL Plus kit (4A Biotech, Beijing, China) for imaging with ChemiScope 3000 mini (Clinx, Shanghai, China).

RNA extraction and quantitative real-time PCR (qRT-PCR) experiment

RAW264.7 cells (1 × 10⁶ cells/well) were treated with the same way of ELISA and lysed in TransZol Up reagent (TransGen Biotech, Beijing, China). RNA was extracted according to the instructions from the manufacturer and quantified with a microplate reader (Tecan Infinite 200 Pro, Switzerland). cDNA was synthesized with Primescript™ First-Strand cDNA Synthesis kit (Takara, Beijing, China). The real-time polymerase chain reaction (PCR) was performed using qTOWER 3G (Analytic Jena, Jena, Germany) with TB Green® Premix Ex Taq™ II kit (Takara, Beijing, China). The obtained amplification data were calculated using GAPDH as internal reference. The specific primers are shown in Table 1.

Table 1. qRT-PCR primer sequences

Primer name	Primer sequences
iNOS-F	CCCTTCCGAAGTTTCTGGCAGCAGC
iNOS-R	GGCTGTCAGAGCCTCGTGGCTTTG
COX2-F	AGAAGGAAATGGCTGCAGAA
COX2-R	GCTCGGCTTCCAGTATTGAG
TNFα-F	TGTCCCTTTCACTCACTGGC
TNFα-R	CATCTTTTGGGGGAGTGCCT
IL-1β-F	AGCTTCAGGCAGGCAGTATC
IL-1β-R	AAGGTCCACGGGAAAGACAC
IL-6-F	GAGTGGCTAAGGACCAAGACC
IL-6-R	AACGCACTAGGTTTGCCGA
GAPDH-F	CACTCACGGCAAATTCAACGGCA
GAPDH-R	GACTCCACGACATACTCAGCAC

NF-κB activation and nuclear translocation assay

RAW264.7 cells (1 × 10⁵ cells/well) seeded in a 6-well plate were treated with CPS or LPS for 6 h. Then, the supernatants were discarded, and the immunofluorescence test was performed according to the instructions from the manufacturer of NF-κB activation nuclear translocation assay Kit (Beyotime, Jiangsu, China). Cells were fixed with the stationary liquid for 15 min and blocked with blocking solution for 1 h at room temperature. The cells were then incubated overnight at 4°C with the primary antibody NF-κB. Following washing, the NF-κB antibody was recycled and further incubated with Cy3-conjugated secondary antibody for 1 h and stained with 4′, 6-diamidino-2-phenylindole (DAPI) for 5 min. Images were captured using a TS2-FL microscope (Nikon, Tokyo, Japan).

Statistical analysis

Three replicates were performed for all experiments, and the results were expressed as mean ± standard deviation. The statistical test was performed using GraphPad Prism, version 8.0.1 (GraphPad Software, San Diego, CA, USA), and the significance analysis was performed by t-test.

Results

Effects of CPS on the cell morphology and viability of RAW264.7 macrophages

In this study, CPS was obtained from C. oleifera fruit shells by hot water extraction, 80% ethanol precipitation, and 25% activated carbon adsorption. The effects of CPS on the cell morphology and viability of RAW264.7 macrophages were evaluated through microscope and MTT assay. The results showed that CPS treatment had little effect on the cell morphology, although LPS treatment resulted in morphological changes (Fig. 1a). And the cell viability of RAW264.7 macrophages in CPS treated group was higher than LPS treated group, which was increased first and then decreased with the increase of CPS concentration (Fig. 1b). These results suggested that CPS has less cytotoxicity.

Fig. 1. Effects of CPS on the cell morphology and viability of RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 24 h. The cell morphology was pictured by microscope (a). The cell viability was evaluated by MTT reagent (b). The data were presented as means ± SD of three separate experiments. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared with control group.

Effects of CPS on the production of NO and PGE2 in RAW264.7 macrophages

NO and PGE2 are two signal molecules produced by macrophages in the activation process. And the release amount of NO and PGE2 indicates the activation degree of macrophages in immune stimulation. The effects of CPS on the production of NO and PGE2 were detected by Griess method and ELISA. The results demonstrated that CPS significantly promoted the production of NO in a dose-dependent manner in RAW264.7 macrophages, and LPS as a positive control induced the production of NO (Fig. 2a). Moreover, the release of PGE2 was gradually increased with the increase of CPS concentration, and at the same time, LPS treatment stimulated the release of PGE2 (Fig. 2b). These results indicated that CPS played a regulatory role in the production of immune molecules in RAW264.7 macrophages.

Fig. 2. Effects of CPS on the production of NO and PGE2 in RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 24 h. The cell supernatants were collected, and the production of NO was detected by Griess assay (a). The PGE2 production was determined by ELISA (b). The data were presented as means ± SD of three separate experiments. ***P < 0.001, ****P < 0.0001 compared with control group.

Effects of CPS on the protein expression of iNOS and COX2 in RAW264.7 macrophages

iNOS and COX2 are two key enzymes responsible for the synthesis of NO and PGE2 in RAW264.7 macrophages with immune stimulation. In this study, the effects of CPS on the protein expression of iNOS and COX2 were analyzed by western blotting. As shown in Fig. 3, CPS treatment significantly upregulated the protein expression of iNOS and COX2, even though LPS induced the protein expression of iNOS and COX2 in a higher level.

Fig. 3. Effects of CPS on the protein expression of iNOS and COX2 in RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 24 h. The cell lysates were obtained, and the protein expression of iNOS (a) and COX2 (b) was detected by western blotting. The data were presented as means ± SD of three separate experiments. ****P < 0.0001 compared with control group.

Effects of CPS on the secretion of immunomodulatory factors in RAW264.7 macrophages

The secretion of immunomodulatory factors is closely related to the degree of immunological response in macrophages. TNFα, IL-1β, and IL-6 are three major immunomodulatory factors in macrophages stimulated by immunogens. Here, the effects of CPS on the secretion of TNFα, IL-1β, and IL-6 in the cell supernatant of RAW264.7 macrophages were detected using the ELISA method. The results displayed that CPS treatment dramatically increased the secretion of TNFα in a dose-dependent manner, although LPS stimulated the secretion of TNFα in a higher level (Fig. 4a). In addition, the secretion of IL-1β and IL-6 was not promoted by the treatment of CPS (Fig. 4b, c). These data suggested that the immunomodulatory activity of CPS may be related to the increase of TNFα secretion in RAW264.7 macrophages.

Fig. 4. Effects of CPS on the secretion of TNFα, IL-1β, and IL-6 in RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 24 h. The cell supernatants were collected, and the secretion of TNFα (a), IL-1β (b), and IL-6 (c) was detected by ELISA. The data were presented as means ± SD of three separate experiments. **P < 0.01, ***P < 0.001 compared with control group.

Effects of CPS on the mRNA level of immune-related molecules in RAW264.7 macrophages

To further evaluate the immunomodulatory activity of CPS, the mRNA levels of immune-related molecules in RAW264.7 macrophages treated with CPS were detected using the RT-PCR method. As presented in Fig. 5, CPS treatment upregulated the mRNA level of TNFα in a dose-dependent manner but had little effect on the mRNA levels of iNOS, COX2, IL-1β, and IL-6 in RAW264.7 macrophages. LPS treatment induced the upregulation of the mRNA levels of all immune-related molecules. And GAPDH was as the internal reference. These results indicated that CPS might play the immunomodulatory activity via upregulating the mRNA level of TNFα.

Fig. 5. Effects of CPS on the mRNA level of iNOS, COX2, TNFα, IL-1β, and IL-6 in RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 24 h. The cell lysates were collected for RNA extraction, and the mRNA levels of iNOS (a), COX2 (b), TNFα (c), IL-1β (d), IL-6 (e), and GAPDH (f) were analyzed using RT-PCR. The data were presented as means ± SD of three separate experiments.

CPS regulated the phosphorylation of MAPK signaling pathway in RAW264.7 macrophages

MAPK signaling pathway plays a significant regulatory role in the immune responses of macrophages. In this study, to evaluate the immune regulatory mechanism of CPS, the activation of MAPKs, including the phosphorylation of ERK, P38, and JNK in RAW264.7 macrophages, was analyzed using western blotting. The results demonstrated that the phosphorylation of ERK was activated by the treatment of CPS, which increased to the highest level at 1 h and then decreased gradually at 2 and 6 h (Fig. 6a, b). Moreover, CPS treatment upregulated the phosphorylation level of p38 and JNK at different time points (Fig. 6a, c and d). These data suggested that CPS activated the phosphorylation of MAPK signaling pathway in a time-dependent manner in RAW264.7 macrophages.

Fig. 6. Effects of CPS on the phosphorylation of MAPKs in RAW264.7 macrophages. Cells were treated with CPS (200 µg/mL) and LPS (1 μg/mL) for the indicated times. The cell lysates were obtained, and the protein expression and phosphorylation of ERK, P38, and JNK were detected by Western blotting. (a) Representative results of western blotting bands. (b-d) The relative phosphorylation levels of ERK (b), P38 (c), and JNK (d) were quantified using image J and normalized to GAPDH. The data are presented as means ± SD of three independent experiments. **P < 0.01, ***P < 0.001, ****P < 0.0001 compared with control group.

CPS caused the nuclear translocation of NF-κB in RAW264.7 macrophages

NF-κB is a classical signaling pathway involved in the regulation of immune and inflammatory responses in macrophages. Here, the nuclear translocation and activation of NF-κB in RAW264.7 macrophages was examined using immunofluorescence technique to explore the mechanism that CPS played an immunomodulatory activity. As the result shown in Fig. 7, the red fluorescence demonstrated that NF-κB remained in the cytoplasm in RAW264.7 macrophages in the resting state and then transferred into the nuclear after treated by CPS at different concentrations for 6 h. LPS was as the positive control, which also promoted the nuclear translocation of NF-κB. This result suggested that CPS treatment caused the activation and nuclear translocation of NF-κB in RAW264.7 macrophages.

Fig. 7. Effects of CPS on the nuclear translocation of NF-κB in RAW264.7 macrophages. Cells were treated with indicated concentrations of CPS (0, 25, 50, 100, and 200 µg/mL) and LPS (1 μg/mL) for 6 h. The cell supernatants were discarded, and the cells were used for the detection of NF-κB nuclear translocation via immunofluorescence. The representative graphs of immunofluorescence were presented from three separate experiments.

Discussion

Several researches have reported that polysaccharides existing widely in living organisms have the ability to regulate immunity by activating macrophages, which play a significant role in host defense against invasion of foreign microorganisms and other pathogens by phagocytosis and secreting several cytokines, including iNOS, PGE2, TNFα, IL-1β, and IL-6 (21–24). Jing and colleagues showed that the polysaccharide derived from Ligustrum lucidum can improve the immune function of immunosuppressed animals, increase the ratio of macrophages, and significantly improve the phagocytic percentage and phagocytic index of peritoneal macrophages in immunosuppressed mice to chicken red blood cells (25). Ji et al. (26) reported that the polysaccharide from Atractylodes macrocephala Koidz can stimulate macrophages and promote the production of NO and TNFα. Lee et al. (27) pointed out that the polysaccharide extracted from the Korean mulberry fruit oddi can activate RAW264.7 cells and promote the release of TNFα and IL-6, which can be used as an effective immune modulator. However, the immunomodulatory activity of the CPS has not been elucidated. In this study, the effects of CPS on the activation of RAW264.7 macrophages were investigated via Griess, ELISA, western blotting, RT-PCR, immunofluorescence technology, etc.

NO and PGE2, as two important immune molecules synthesized and secreted by macrophages, were mainly derived from L-arginine and arachidonic acid by the action of iNOS and COX2, respectively (28). When the macrophages were stimulated by a foreign substance, the production of NO and PGE2 will be significantly improved. In our results, the production of NO and PGE2 and the protein expression of iNOS and COX2 were increased by the treatment of CPS (Figs. 1 and 2). However, the mRNA levels of iNOS and COX2 were not improved by the treatment of CPS (Fig. 4a, b). These results suggested that the effect of CPS on the expression of iNOS and COX2 may be at the translation level but not the transcription level.

Moreover, macrophages in the activated state can also produce a variety of immune-related cytokines such as TNF-α, IL-1β, and IL-6, which are considered the major mediators in several cell processes, including immune reaction, inflammatory response, cell proliferation, and cell apoptosis (6–9, 29). In this study, our data indicated that CPS treatment induced the secretion of TNFα and improved its mRNA level in RAW264.7 macrophages, but the release of IL-1β and IL-6 and their mRNA levels were not increased by the treatment of CPS. These results indicated that the immune activity of CPS on RAW264.7 macrophages may be closely related to the release of TNFα, but not IL-1β and IL-6.

In addition, MAPKs and NF-κB signaling pathways are closely related to the activation of macrophages stimulated by polysaccharides, which can regulate the secretion and maturation of immune molecules and related cytokines in macrophages (30). Xu and colleagues pointed out that Pleurotus eryngii polysaccharide can induce the secretion of immune-related cytokines and promote the phosphorylation of JNK, ERK, and P38 in RAW264.7 cells (31). Long et al. (32) reported that Polygonatum sibiricum polysaccharide can trigger MAPK and NF-κB pathways, produce cytokines, and activate JNK, ERK, and P38 proteins. Our results demonstrated that CPS treatment significantly promoted the phosphorylation levels of ERK, JNK, and P38 in RAW264.7 macrophages at different time points. The activation and nuclear translocation of NF-κB were regulated by the treatment of CPS. These data implied that the effects of CPS on immune responses of RAW264.7 macrophages were achieved through activating MAPK and NF-κB signaling pathways.

Conclusion

In this study, the immunoregulatory activities and underlying mechanisms of CPS in RAW264.7 macrophages were investigated. The data indicated that CPS increased the production of NO and PGE2, enhanced the protein expression of iNOS and COX2, and promoted the secretion and mRNA level of TNFα via activating the phosphorylation of MAPKs and nuclear translocation of NF-κB in RAW264.7 macrophages.

Acknowledgments

This work was funded by the Science and Technology Major Project Foundation of Jiangxi Academy of Sciences (2020-YZD-1 and 2021YSBG10001), the Science Foundation for Young Doctors of Jiangxi Academy of Sciences (2020-YYB-20), and the General Project of Key Research and Development Program of Jiangxi Academy of Sciences (2021YSBG22028).

Authors’ contribution

XCQ and WL conceived and designed the research. XCQ and LXY conducted experiments. XW and HJW contributed new reagents or analytical tools. WSF and WJ analyzed the data. LXY and XCQ wrote the manuscript. All authors read and approved the manuscript.

References

1.	Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature 2013; 496(7446): 445–55. doi: 10.1038/nature12034
2.	Janeway CA, Jr, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002; 20: 197–216. doi: 10.1146/annurev.immunol.20.083001.084359
3.	Xie C, Wang S, Cao M, Xiong W, Wu L. (E)-9-Octadecenoic acid ethyl ester derived from lotus seedpod ameliorates inflammatory responses by regulating MAPKs and NF-kappaB signalling pathways in LPS-induced RAW264.7 macrophages. Evid Based Complement Alternat Med 2022; 2022: 1–9. doi: 10.1155/2022/6731360
4.	Bernd M, Benjamin H. Biosynthesis and action of nitric oxide in mammalian cells. Trends Biochem Sci 1997; 22(12): 477–81. doi: 10.1016/s0968-0004(97)01147-x
5.	Cheng H, Huang H, Guo Z, Chang Y, Li Z. Role of prostaglandin E2 in tissue repair and regeneration. Theranostics 2021; 11(18): 8836–54. doi: 10.7150/thno.63396
6.	Peters M, Meyer zum Büschenfelde KH, Rose-John S. The function of the soluble IL-6 receptor in vivo. Immunol Lett 1996; 54(2–3): 177–84. doi: 10.1016/s0165-2478(96)02669-7
7.	Tian J, Zhang C, Wang X, Rui X, Zhang Q, Chen X, et al. Structural characterization and immunomodulatory activity of intracellular polysaccharide from the mycelium of Paecilomyces cicadae TJJ1213. Food Res Int 2021; 147: 1–13. doi: 10.1016/j.foodres.2021.110515
8.	van Horssen R, Ten Hagen TLM, Eggermont AMM. TNF-α in cancer treatment-molecular insights, antitumor effects, and clinical utility. Oncologist 2006; 11(4): 397–408. doi: 10.1634/theoncologist.11-4-397
9.	Lopez-Castejon G, Brough D. Understanding the mechanism of IL-1 beta secretion. Cytokine Growth Factor Rev 2011; 22(4): 189–95. doi: 10.1016/j.cytogfr.2011.10.001
10.	Xu Y, Lei C. TAK1-TABs complex: a central signalosome in inflammatory responses. Front Immunol 2021; 11: 1–12. doi: 10.3389/fimmu.2020.608976
11.	Jia XJ, Li X, Wang F, Liu HQ, Zhang DJ, Chen Y. Berbamine Exerts anti-inflammatory effects via inhibition of NF-kappaB and MAPK signaling pathways. Cell Physiol Biochem 2017; 41(6): 2307–18. doi: 10.1159/000475650
12.	Wancket LM, Frazier WJ, Liu Y. Mitogen-activated protein kinase phosphatase (MKP)-1 in immunology, physiology, and disease. Life Sci 2012; 90(7–8): 237–48. doi: 10.1016/j.lfs.2011.11.017
13.	Carter AB, Knudtson KL, Monick MM, Hunninghake GW. The p38 mitogen-activated protein kinase is required for NF-κB-dependent gene expression. The role of TATA-binding protein (TBP). J Biol Chem 1999; 274(43): 30858–63. doi: 10.1074/jbc.274.43.30858
14.	Cha SM, Cha JD, Jang EJ, Kim GU, Lee KY. Sophoraflavanone G prevents Streptococcus mutans surface antigen I/II-induced production of NO and PGE2 by inhibiting MAPK-mediated pathways in RAW 264.7 macrophages. Arch Oral Biol 2016; 68: 97–104. doi: 10.1016/j.archoralbio.2016.04.001
15.	Hoffmann A, Baltimore D. Circuitry of nuclear factor κB signaling. Immunol Rev 2006; 210: 171–86. doi: 10.1111/j.0105-2896.2006.00375.x
16.	Giridharan S, Srinivasan M. Mechanisms of NF-kappaB p65 and strategies for therapeutic manipulation. J Inflamm Res 2018; 11: 407–19. doi: 10.2147/JIR.S140188
17.	Park MY, Ha SE, Kim HH, Bhosale PB, Abusaliya A, Jeong SH, et al. Scutellarein inhibits LPS-induced inflammation through NF-kappaB/MAPKs signaling pathway in RAW264.7 cells. Molecules 2022; 27(12): 1–9. doi: 10.3390/molecules27123782
18.	Xie Y, Ge S, Jiang S, Liu Z, Chen L, Wang L, et al. Study on biomolecules in extractives of Camellia oleifera fruit shell by GC-MS. Saudi J Biol Sci 2018; 25(2): 234–6. doi: 10.1016/j.sjbs.2017.08.006
19.	Jin X. Bioactivities of water-soluble polysaccharides from fruit shell of Camellia oleifera Abel: antitumor and antioxidant activities. Carbohydr Polym 2012; 87(3): 2198–201. doi: 10.1016/j.carbpol.2011.10.047
20.	Zhang S, Li X. Hypoglycemic activity in vitro of polysaccharides from Camellia oleifera Abel. seed cake. Int J Biol Macromol 2018; 115: 811–9. doi: 10.1016/j.ijbiomac.2018.04.054
21.	Schepetkin IA, Quinn MT. Botanical polysaccharides: macrophage immunomodulation and therapeutic potential. Int Immunopharmacol 2006; 6(3): 317–33. doi: 10.1016/j.intimp.2005.10.005
22.	Ma H, Liu G, Ding W, Wu Y, Cai L, Zhao Y. Diabetes-induced alteration of F4/80+ macrophages: a study in mice with streptozotocin-induced diabetes for a long term. J Mol Med (Berl) 2008; 86(4): 391–400. doi: 10.1007/s00109-008-0304-8
23.	Hume DA. The mononuclear phagocyte system. Curr Opin Immunol 2006; 18(1): 49–53. doi: 10.1016/j.coi.2005.11.008
24.	Schepetkin IA, Xie G, Kirpotina LN, Klein RA, Jutila MA, Quinn MT. Macrophage immunomodulatory activity of polysaccharides isolated from Opuntia polyacantha. Int Immunopharmacol 2008; 8(10): 1455–66. doi: 10.1016/j.intimp.2008.06.003
25.	Jing SJ, Bo S, Mingsan M, Qingya L. Effect of Ligustrum lucidum polysaccharide on immunity of immunosuppressed mice. Bangladesh J Pharmacol 2016; 11: S68–71. doi: 10.3329/bjp.v11iS1.26919
26.	Ji GQ, Chen RQ, Zheng JX. Macrophage activation by polysaccharides from Atractylodes macrocephala Koidz through the nuclear factor-kappaB pathway. Pharm Biol 2015; 53(4): 512–7. doi: 10.3109/13880209.2014.929152
27.	Lee JS, Synytsya A, Kim HB, Choi DJ, Lee S, Lee J, et al. Purification, characterization and immunomodulating activity of a pectic polysaccharide isolated from Korean mulberry fruit Oddi (Morus alba L.). Int Immunopharmacol 2013; 17(3): 858–66. doi: 10.1016/j.intimp.2013.09.019
28.	Alam MB, Chowdhury NS, Sohrab MH, Rana MS, Hasan CM, Lee SH. Cerevisterol alleviates inflammation via suppression of MAPK/NF-kappaB/AP-1 and activation of the Nrf2/HO-1 signaling cascade. Biomolecules 2020; 10(2): 1–13. doi: 10.3390/biom10020199
29.	Wang Y, Zhang Y, Shao J, Ren X, Jia J, Li B. Study on the immunomodulatory activity of a novel polysaccharide from the lichen Umbilicaria Esculenta. Int J Biol Macromol 2019; 121: 846–51. doi: 10.1016/j.ijbiomac.2018.10.080
30.	Wei H, Wang Y, Li W, Qiu Y, Hua C, Zhang Y, et al. Immunomodulatory activity and active mechanisms of a low molecular polysaccharide isolated from Lanzhou lily bulbs in RAW264.7 macrophages. J Funct Foods 2022; 92: 1–15. doi: 10.1016/j.jff.2022.105071
31.	Xu D, Wang H, Zheng W, Gao Y, Wang M, Zhang Y, et al. Charaterization and immunomodulatory activities of polysaccharide isolated from Pleurotus eryngii. Int J Biol Macromol 2016; 92: 30–6. doi: 10.1016/j.ijbiomac.2016.07.016
32.	Long T, Liu Z, Shang J, Zhou X, Yu S, Tian H, et al. Polygonatum sibiricum polysaccharides play anti-cancer effect through TLR4-MAPK/NF-kappaB signaling pathways. Int J Biol Macromol 2018; 111: 813–21. doi: 10.1016/j.ijbiomac.2018.01.070